circad | circRNAs associated with diseases

hsa_circ_0001445
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink		PMID	29785229
Experimental Method
Sample Type	Tissue and cell lines	Comparison	A total of 73 pairs of HCC and adjacent nontumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAAGATGGGCGAAAGTTCACT Reverse TGTGTTGCTCCATGTCTAATCATT	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Zhang, X, Zhou, H, Jing, W, Luo, P, Qiu, S, Liu, X, Zhu, M, Liang, C, Yu, M, Tu, J (2018). The Circular RNA hsa_circ_0001445 Regulates the Proliferation and Migration of Hepatocellular Carcinoma and May Serve as a Diagnostic Biomarker. Dis. Markers, 2018:3073467.